Bond on deoxyribonucleic acid strands

Restriction enzymes break a phosphodiester bond on deoxyribonucleic acid strands, such that only one end of each molecule is cut and these ends have regions of single-stranded deoxyribonucleic acid. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.What is the objective of this action?

Explain how the gene of interest is introduced into a vector.

You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many deoxyribonucleic acid fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.