Terminal of neuromuscular junction

/in /by

Discuss how nerve impulse (action potential) at axon terminal of neuromuscular junction causes skeletal muscle contraction..The neuromuscular junction (NMJ) is a synaptic connection between the terminal end of a motor nerve and a muscle (skeletal/ smooth/ cardiac). It is the site for the transmission of action potential from nerve to the muscle. It is also a site for many diseases and a site of action for many pharmacological drugs

List the steps and describe them shortly

Cycling through the biogeochemical processes

/in /by

Consider nutrient cycling through the biogeochemical processes that occur  Biogeochemical cycles important to living organisms include the water, carbon, nitrogen, phosphorus, and sulfur cycles.  Please describe how the different cycles (e.g. carbon, water, nitrogen, phosphorus) interact with one another and their balance.  What happens if one cycle does not function?  How does that impact ecosystem function?

Structures that angiosperms have

/in /by

Structures that angiosperms have that are lacking in Gymnosperms. How do these 2 structures help angiosperms? have seeds that are enclosed within an ovary (usually a fruit), while gymnosperms have no flowers or fruits, and have unenclosed or “naked” seeds on the surface of scales or leaves

Angiosperm success is a result of two novel structures that ensure reproductive success: flowers and fruit. Flowers allowed plants to form cooperative evolutionary relationships with animals, in particular insects, to disperse their pollen to female gametophytes in a highly targeted way.

Bond on deoxyribonucleic acid strands

/in /by

Restriction enzymes break a phosphodiester bond on deoxyribonucleic acid strands, such that only one end of each molecule is cut and these ends have regions of single-stranded deoxyribonucleic acid. BamH1is one such restriction enzyme which binds at the recognition sequence, 5’-GGATCC- 3’and cleaves these sequences just after the 5’- guanine on each strand.What is the objective of this action?

Explain how the gene of interest is introduced into a vector.

You are given the DNA shown below. 5’ ATTTTGAGGATCCGTAATGTCCT 3’ 3’ TAAAACTCCTAGGCATTACAGGA 5’ If this DNA was cut with BamHI, how many deoxyribonucleic acid fragments would you expect? Write the sequence of these double-stranded DNA fragments with their respective polarity.

Resources required for the coaching

/in /by

In your response refer to the coaching required What resources required for the coaching Where the coaching was held how you calculated the duration of the coaching session’s any Information that you needed to provided as part of the coaching Explain the process you took to organise the session’s for this coochee.

Function of lactic acid bacteria (LAB)

/in /by

The function of Lactic  Acid Bacteria (LAB) is very effective for improving soil ventilation and for growing fruits and leafy vegetables. The initial growth of the plant, when LAB is used during the vegetative growth period of fruiting vegetables, higher quality plants will result, and may be kept for longer periods, in storage.

Nuclei of amygdala in fear learning

/in /by

Discuss roles of central, lateral and basal nuclei of amygdala in fear learning. Irrespective of the specific site of storage for fear associations, these, and other studies, have collectively demonstrated that the amygdala plays an essential role in either storing fear-related memories or facilitating consolidation of fear-related memories in other brain regions.

Importance of preserving biodiversity

/in /by

Importance of preserving biodiversity in a culture angle. The variety of plant and animal life in the world or in a particular habitat, a high level of which is usually considered to be important and desirable.Biodiversity is essential for the processes that support all life on Earth, including humans. Without a wide range of animals, plants and microorganisms, we cannot have the healthy ecosystems that we rely on to provide us with the air we breathe and the food we eat

The cubic capacity of the braincase

/in /by

The cubic capacity of the braincase estimated for the living by a formula based on head measurements and determined for the skull by filling the cranial cavity with particulate material (as mustard seed or small shot) and measuring the volume of the latte.Use two examples to demonstrate brain’s capacity to adapt to environmental stimuli (insults) during development

A fish dissection lab report

/in /by

An introduction on a fish dissection lab report aiming to examine the internal and external anatomy of fish.In most fish species, fertilization takes place externally. These fish are oviparous. Eggs are laid and embryos develop outside the mother’s body. In a minority of fish, including sharks, eggs develop inside the mother’s body but without nourishment from the mother.